Concept

Backtracking search — where it appears

Walking a backward search as a tree, branching over the alphabet and spending one unit of budget at every step that does not match. It never leaves the index and reads no character of the text, and its cost multiplies by roughly an order of magnitude for each error allowed.

Named by 14 essays across 7 fields — each of them below, with the objects they name alongside it.

10010³10⁴10⁵errors allowed, kacts01234index walkthe whole table4,000 characters · m = 16 · 4 symbolscrossing at k = 4

The branches an error opens

The tree multiplies by 19.6 for the first error, 12.3 for the second, 10.3 for the third and 8.8 for the fourth. A branching factor of four on a sixteen-character pattern would predict sixty-four, and the gap between sixty-four and eight is the intervals emptying.

bounds · Distance
10010³10⁴errors allowed, kacts0123index walkthe whole table3,000 characters · m = 20 · 4 symbolsno crossing in range

The search that spends a budget

A backward search narrows one interval per pattern character. Give it a budget of three errors and it narrows 39,943 of them instead, finds every occurrence the whole table finds, and reads not one character of the text — 177,046 index ranks against 60,000 table cells and zero characters examined.

indexes · Distance
010010³10⁴interval extensions48.1%68.5%69.8%errors allowed · share removed belowno pruningpruned on D4,000 characters · m = 1669.8% removed at k = 3

The branch that cannot reach an answer

Seventy-two rank operations over the pattern remove 27,906 of the 39,957 interval extensions a bounded-error index walk performs — 70% of the tree, at a budget of three. The share grows with the budget, which is what a pruning has to do to be worth its cost.

bounds · Distance
atgaattcatgagtgacaag00000111111112222222errorsthe pattern, left to right · D belowleast errors neededD, the bound4 symbols · m = 2090 ranks · 2 resets

The errors the rest of the pattern needs

Read the pattern left to right in an index of the reversed text and count the points where the interval empties. That count is a lower bound on the errors any alignment of the prefix must contain, it costs 72 rank operations, and it removes 70% of a search tree.

text · Distance
ranks to compute D72extensions removed27,906extensions remaining12,051one search · k = 3 · 4,000 charactersand one more index: 17,033 bits4,000 characters · m = 16388 extensions a rank

A bound that has to be paid for

The pruning removes seventy per cent of a search tree for seventy-two rank operations. It also needs an FM-index of the reversed text — 17,033 bits against the forward index's 17,032 — which doubles the structure whose small size was the entire argument for walking an index.

space · Distance
the whole table60,00060,000r · 0rkcounting filter24,84315,369r · 0rkseed filter17,7452,415r · 1,377rkindex walk00r · 177,046rkn = 3,000 · m = 20 · q = 4cells drawn · r = characters read, rk = index rankscells computed6 occurrences

Three savings in three currencies

The same six occurrences, found four ways. The table computes 60,000 cells and reads 60,000 characters. The counting filter computes 6,251 cells and reads 13,022 characters. The seed filter computes 3,325 and reads 550. The index walk computes none, reads none, and performs 18,645 ranks.

wrong · Distance
atgaattcatgagtgacaag00000111111112222222errorsthe pattern, left to right · D belowleast errors neededD, the bound4 symbols · m = 2090 ranks · 2 resets

The pruning that loses an occurrence

Two versions of the same lower-bound pruning, each one character away from correct. Both return only real occurrences, both return fewer of them, and no check that asks whether the answers are right can tell either from the truth.

wrong · Distance
binary · sigma 22.00x2 against 4dna · sigma 42.67x6 against 16protein · sigma 204.76x42 against 200latin · sigma 264.81x54 against 26064-position interval2.00x to 4.81x

Two at binary, five at twenty-six

The saving is a factor in the alphabet, so a two-symbol alphabet gets two. Approximate matching in this field is mostly done on DNA, which sits near the bottom of the list at 2.7.

bounds · Symbol
025507510000.50011.502errors permittedfactor against the published loop64.5%55.8%74.7%the walk: 11xthe descentthe label is the shareof dead extensions6 patterns · sigma 2198x to 105x

Flat in the budget, and not

One saving is eleven times at every error budget, because it is a property of the alphabet. The other moves between ninety-eight and a hundred and five, because it follows the share of extensions that find nothing. Two savings, two shapes, and neither line crosses the other.

bounds · Distance
acdefghijklmnopqrstuvwyzroot24 of 26 symbols present54 ranks · 51 nodes

Asking about symbols that are not there

A search extends an interval by every character of the alphabet, and on a deep branch almost all of them produce an empty interval. That is a full rank walk whose entire result is the discovery that nothing was there.

indexes · Symbol
extensions attempted9,206 dead7,594 livebit-vector ranksthe loop: 168,000the descent: 24,0868 patterns · 1 error · sigma 2054.8% dead · 6.98x

The branches that find nothing

An approximate search over a twenty-symbol alphabet attempts sixteen thousand eight hundred extensions and nine thousand two hundred of them produce an empty interval. That is a full rank walk whose entire result is the discovery that nothing was there.

structures · Symbol
a loop over the alphabet1,478,400the compound walk, inside the loop134,40011xone descent per node18,91678x6 patterns · 1 error · sigma 2155.8% of the extensions were dead

Three savings on one structure

A factor of eleven on an extension, a factor of seven on a branching search, and a sixth of the bits. Applied to one bidirectional index they do not give a factor of seventy-seven, and the reason is that two of the three are the same saving.

indexes · Distance
02040608000.50011.502errors permittedbranches that find nothing, per cent5.75x6.98x9.22xthe label is thesaving at that budget8 patterns · 8 characters31.3% to 74.9%

A looser budget wastes a larger share

More errors permitted means more work, and the fraction of that work which was never going to help rises with it — from thirty-one per cent at no errors to seventy-five at two. The saving is worth most where the search is most expensive.

practice · Symbol
a loop over the alphabet107.9the compound walk10.0the cheapest hereone descent per step19.016 exact patterns of 12ranks per step · sigma 21

The saving that is a loss

An operation that is seventy-eight times cheaper on a branching search costs twice as much on an exact one. It reports every symbol present in order to hand back the one that was asked for, and a search that knows its character needs none of the rest.

practice · Distance

Named alongside it

The objects these essays reach for when they reach for this one.

Error budgetApproximate matchingInterval symbolsMeasurementAlphabet sizeFM-indexPruningBackward searchDead branchDescentEdit distanceLower bound

All concepts