The collection

Every essay — page 13

Page 13 of 13, continuing through the fields in the same order.

What a bound is Counting The floors What the machine does Structures Two parameters The other axis When the algorithm flips a coin What the libraries do When it does not fit One pass, and no room The data that is not a number When the algorithm is a table The index that replaces the text What is taught wrongly Ladders Objects Search

What is taught wrongly

The comparisons that are made without units, the averages quoted without their distributions, and the bounds treated as predictions of speed.

73 characters long24 runsto depth 7270 characters long24 runsto depth 69longest: 73 × "-" at position 11,0162,685 positions below depth 20, 2,685 of them inside a runeight source modules · worst depth 78100.0% in runs

The deepest text is punctuation

Eight source files reach depth 78 in a parse, on a collection with no version history in it at all. The positions between depth 20 and depth 72 are the same 48 characters at every level, and every one of them is a dash in a comment separator.

7 figures
the whole table60,00060,000r · 0rkcounting filter24,84315,369r · 0rkseed filter17,7452,415r · 1,377rkindex walk00r · 177,046rkn = 3,000 · m = 20 · q = 4cells drawn · r = characters read, rk = index rankscells computed6 occurrences

Three savings in three currencies

The same six occurrences, found four ways. The table computes 60,000 cells and reads 60,000 characters. The counting filter computes 6,251 cells and reads 13,022 characters. The seed filter computes 3,325 and reads 550. The index walk computes none, reads none, and performs 18,645 ranks.

8 figures
short by 133.6% of pairsshort by 211.2% of pairsshort by 411.2% of pairsthe same shift7994.0% of pairspatterns of 10 over four symbolsthe published rule is never the larger of the twoshift decisions84 pairs · 21 nodes

What the approximation gives up

Compared at every one of the 3,736 decisions a search could ask about, the published shift rules and the exact ones agree at all of them on a set of 128 patterns. At two patterns they differ at five of 84, by up to four positions — and the run reads 6.3% more characters.

9 figures
candidates, filtering4,355candidates, grid33rank and select, grid2,471occurrences32one query · same collection · same answer16,384 characters · 32 occurrencescandidates 132x · operations 1.76x

The operations a candidate count leaves out

The grid examines 33 candidates where the scan examines 4,355 — a factor of 132. Counted in the operations each of them performs, the same query is 2,471 against 4,355, and the factor is 1.8.

7 figures
a text that repeats itself2.96xchain 13 · z 110English-like1.31xchain 10 · z 604four symbols, uniform1.28xchain 10 · z 816periodic, period 171.11xchain 9 · z 1,285phrases under a cap of four, against no cap4,096 characters each2.96x to 1.11x

The cap that binds on one text and not another

A periodic text looks like the one made of chains and pays 1.11 times the phrases for a cap of four. A text that repeats itself pays 2.96. The guess is backwards, and the reason is that depth measures nesting rather than repetition.

7 figures
0102030255075100125one sampled position in every …of both halves saved, per cent"about a sixth"the marks alone: 14.0%8,192 characters16.7% at one in 32

A sixth of what, exactly

The saving from a counting-only reverse half is 30.5% at one sampled position in four and 14.0% at one in a hundred and twenty-eight. A number quoted without its sampling rate is a number about a setting somebody chose.

9 figures
atgaattcatgagtgacaag00000111111112222222errorsthe pattern, left to right · D belowleast errors neededD, the bound4 symbols · m = 2090 ranks · 2 resets

The pruning that loses an occurrence

Two versions of the same lower-bound pruning, each one character away from correct. Both return only real occurrences, both return fewer of them, and no check that asks whether the answers are right can tell either from the truth.

8 figures
101001,00010100total length of the pattern settimes the published rule's precomputationwritten as a definitionbuilt from the linksthe published rulefour symbols · m = 10137x becomes 1.60x

The ratio that was an implementation

This collection published a factor of forty-two between two shift rules' preprocessing. Sixty-nine per cent of the denominator was a table the published rule never reads, and the numerator was a definition rather than a construction. The corrected ratio is 1.6.

7 figures
46812windowswindow lengthspanning a joinin no documentwith a separatorEnglish-like · 8 documents44 invented at m = 12

The occurrences a join invents

Eight documents run together hold forty-nine eight-character windows that span a join, twenty-three of which occur in no document at all. Every index built over the concatenation reports them, and five essays of this collection paid that cost silently.

7 figures
errors, by piecetaken by(0, 0, 0)1(0, 0, 1)1(0, 0, 2)1(0, 1, 0)1(0, 1, 1)1(0, 2, 0)3(1, 0, 0)2(1, 0, 1)2(1, 1, 0)3(2, 0, 0)30 of 10 covered more than once · the numbers are the searchesk = 2 · 3 pieces10 distributions

A schedule nobody writes down

A search scheme is valid when its searches between them cover every way the errors can fall — ten cases at two errors, enumerable in a line. A scheme missing one of them finds seven occurrences of eight, all real, at the right error counts, and reports nothing wrong.

9 figures
02e+34e+36e+301234567891011level of the wavelet treebitsplainblock-codedrun-coded3,612 points · 12 levels24 copies of 2048 characters

The level where compression stops paying

Choosing the best coding for every level of the grid separately, rather than one for all twelve, saves 26 bits out of 47,668 — five hundredths of one per cent. The apparatus for choosing costs more than that to describe.

9 figures
11010⁴cap on the depthphrasesno capcap 165,536 characters · 16 copies26x at cap 1

What a quadratic construction was setting

A depth cap of one costs 90% of an 8,192-character text in phrases, and 86% of a 65,536-character one. The ladder's conclusions hold at thirty-two times the size — and the number the ladder could not reach, the deepest chain a real collection produces, turns out to be fourteen.

8 figures
1.0%10.0%0.11fraction of characters changedper characterthe real runsthe real phrasesgenerated runsgenerated phrasesten revisions of one file · 24,580 characters2.32% against 3.24%

The dial that has no setting

The generator has one parameter. The real version history's run count asks it for 2.3% and its phrase count asks for 3.2% — and the reason is not that the dial is badly calibrated. Real edits average 7.3 characters a block and generated ones average 1.04.

9 figures
1101000.1documentsruns of the transform, per characterprose: 1.10xcopies: 1.02x8,192 characters, cutthe control rises further

A boundary that costs nothing

A separator occurs nowhere else in the collection, so it must break a phrase that would have spanned it. Cutting a repetitive text into a hundred and twenty-eight documents raises its run count by two per cent, and cutting prose raises it by ten.

7 figures
prose, many short documents4.31 most frequent3.07 drawn from a documentone copy per document5.75 most frequent1.81 drawn from a documentcopies cut across the boundaries5.81 most frequent1.88 drawn from a documentoccurrences per document holding the pattern16 documents · 6-character patternsall three within a tenth on the drawn pattern

One copy per document is one occurrence per document

The output-sensitive listing apparatus wins when a pattern occurs far more often than it occurs in documents. A collection of versions was supposed to be that case, and it is the one collection where the two numbers are equal by construction.

8 figures
equal lengths5.00 bits100.0%lengths as one over rank4.15 bits83.4%a few long, many short4.31 bits86.7%one document holding most of the text1.69 bits39.5%log₂ 3232 documents · 8,192 characters100.0% to 39.5%

A saving quoted without its collection

A check asking whether a compressed document array is smaller than the plain one passes on the rounding whenever the document count is not a power of two. It would report a saving of nothing as sixteen per cent, on a collection that has no redundancy at all.

8 figures
a fixed-length codeleaves in orderacdefghilmnoprstuvwythe best ordered treeleaves in orderacdefghilmnoprstuvwythe best tree of any shapeleaves in frequency ordereahnrstdiloucfgmpvwythe symbols, in the order the descent reports them21 symbols in 2,048 positionsone set, 2 of 3 sorted

One set, three orders

The symbols an interval holds do not depend on the tree's shape. The order they come out in does, and a search that accumulates a running count as it reads them computes a plausible number that is wrong on eighty per cent of queries.

8 figures
acdefghijklmnopqrstuvwyzroot24 of 26 symbols present54 ranks · 51 nodes

A walk that does not prune

Remove the emptiness test and the descent visits every node of the tree, returns exactly the same symbols with exactly the same intervals, and costs sixty per cent more. No test of the answer can see it.

8 figures
01e+42e+43e+44e+450100one sampled position in every …bitsplain, one bit a rowcompressed blocksElias-Fano16,384 rowscrosses at one in 4

Where the sparse representation loses

At every row marked, Elias–Fano costs twice the plain vector. The crossing is at one row in four, which is a sampling rate a real index uses — so the choice between the two is a choice, not an improvement.

9 figures
bits heldthe model3,591the structure3,905one rank, in operationsbinary search10 stepsselect and walk1 select + 0.7016,385 rows · one in 32 marked14x on the operation

A price with no structure under it

A class in this collection has charged Elias–Fano's price for several strands and stores an array of positions searched by binary search. The accounting is right about space to a bit per thousand and wrong about one operation by a factor of eight.

8 figures
factor against the published loopthe compound walk11xthe enumeration78xthe two, multiplied860xnothing measures thisan index with both78xthe shortfall is 11x, and the walk's factor is 11x6 patterns · 1 error · sigma 21the larger of the two, not the product

Two factors that do not multiply

Eleven times and seventy-eight times against the same baseline, so an index with both should be eight hundred and sixty. It is seventy-eight, and the shortfall is eleven — the first factor, exactly, because the second operation already contains it.

9 figures
0100200300400102030copies of the basebits held during one querythe visited set: 420the frontier: 2666-character patterns20x to 1.58x

A constant factor, not a term

The substitution was expected to remove a quantity proportional to the answer. Both traversals hold a quantity proportional to the answer, and what it removes is a factor of 1.6 that shrinks as the collection grows.

8 figures
10100states the cache holdsoperations a characterthe plain NFA: 52.5the whole set fits: 19.94,096 characters · k = 8the knee is at 512 states

A cache below the reachable set

A lazy machine with a cache of two hundred and fifty-six states costs fifty-one operations a character and a plain non-deterministic simulation costs fifty-three. At five hundred and twelve it costs eleven. The line is flat across two orders of magnitude and then falls off a cliff.

8 figures
1010³10⁴10⁵10⁶characters of textstepsbacktrackingThompson's NFAopen points: capped at4,000,000(a|a)*b12,158x at 20 characters

The folklore is about a matcher

Four million steps against three hundred and twenty-nine, on a twenty-character expression matched against twenty characters. One of the two machines doubles with every character of the input and the other does not, and only one of them is what a regular expression is.

8 figures