Concept

Trade off — where it appears

An exchange in which one resource is bought with another, visible only once both are counted, and often not an exchange at all when only one is. It is only an exchange once both resources are counted, and a great many published trade-offs turn out to be a loss on both axes when they are.

Named by 101 essays across 14 fields — each of them below, with the objects they name alongside it.

suffix array + text311,29619.00 b/chcounter array per symbol5,407,710330.06 b/chFM-index, plain100,9476.16 b/chFM-index, compressed36,8042.25 b/chthe packed textone bar shaded darker needs the text · English-likesigma 21, sample 64

An index larger than what it indexes

A suffix array over 16,384 characters is 229,376 bits, and it cannot answer a single question without the 81,920 bits of text beside it. Nearly four times the text, to search the text. Every index on this site had been weighed at zero until somebody put one on a scale.

indexes · Index
1,00010,0000.1bits of state heldrelative errorHyperLogLog (-0.49)LogLog (-0.44)bottom-k (-0.38)50,000 distinct keys · 14 runs per point · truth counted exactlybest: 2.00% at 10,240 bits

The answer that is allowed to be wrong

Every algorithm on this site so far was checked for correctness before it was measured. A summary of a stream cannot be — the data goes past once and does not fit — so the error becomes a resource, bought with bits, at an exchange rate that is a measurement.

streaming · Sketch
0.1bits the register neededrelative errora = 2a = 1.5a = 1.2a = 1.1a = 1.05a = 1.02√((a−1)/2), predicted200 runs per base · n = 20,000 · exact counter needs 15 bits72.6% at 5 bits

Counting past what the register holds

Morris's counter counts ten million events in five bits by incrementing with probability 2 to the minus c. The estimate is exactly unbiased at every n, its relative error is 71%, and the base is a dial that trades one against the other at a rate of the square root of half of a minus one.

streaming · Sketch
comparisonsswapsInsertion sort63,071 / 0Selection sort130,816 / 504Bubble sort129,688 / 62,563Merge sort3,964 / 0Heapsort7,653 / 4,170Quicksort5,049 / 2,380n = 512, random inputcounted in the same run

One run, four counts, four answers

The question “how many operations” has no answer until the operation is named. Selection sort makes more comparisons than any other algorithm here and fewer writes than almost all of them; bubble sort matches its comparisons and does 124 times the swapping. The ranking depends entirely on which count is chosen, and the choice needs justifying.

counting · Count
10⁵10⁶10⁷11010010³10⁴comparisonspeak auxiliary slotsInsertion sortSelection sortBubble sortMerge sortHeapsortQuicksortQuicksortQuicksortShellsortMerge sort with a cutoffn = 8,192, random input5 on the frontier, 5 dominated

The frontier between time and space

The question of which sorting algorithm to use has an honest answer, and it is a shape rather than a name. Comparisons on one axis, peak auxiliary space on the other, and five of the ten algorithms here are on the Pareto frontier while five are dominated — beaten on both counts at once, so that no weighting of the two costs makes them the right choice. Heapsort is one of the five that lose.

space · Space
a text that repeats itselfH0 4.01 · H3 0.236.291.48an order-1 sourceH0 3.00 · H3 0.895.151.67English-likeH0 3.89 · H3 0.976.162.25four symbols, uniformH0 2.00 · H3 1.994.102.59eight symbols, uniformH0 3.00 · H3 2.835.143.65bits per character of textupper bar: plain bit vectors · lower bar: compressed16,384 characters each · sample rate 64sigma 21, 8, 21, 4, 8

The index that is smaller than the text

The Burrows–Wheeler transform is a permutation, so it changes no symbol frequency and a plain index over it is the same size whether the text has deep structure or none — 6.29 bits a character against 6.16, on texts whose third-order entropies differ fourfold. What the transform changed was the runs, and a structure that charges one bit per bit cannot see a run.

indexes · Index
acgtacgtseen ->0313303113033130a gap of k characters costs 2krows: expected · columns: seen · unit: bitslinear gaps

A cost that is not one

The same eighty-one cells, filled by the same recurrence, return 6, 10, 10 and 15 — in edits, in cost, in bits and in bits again. Only the first is a count of anything, two of them are equal by arithmetic coincidence, and the alignment each one chooses is different.

tables · Cost
comparisonsswapsInsertion sort63,071 / 0Selection sort130,816 / 504Bubble sort129,688 / 62,563Merge sort3,964 / 0Heapsort7,653 / 4,170Quicksort5,049 / 2,380n = 512, random inputcounted in the same run

The count somebody chose

Six quantities can now be measured for every sort. Ranking the ten algorithms by each of them and comparing the orders, comparisons and peak space disagree about 91% of all pairs, and memory traffic and modelled misses disagree about 7%. There is no ranking of sorting algorithms; there are six, and choosing between them is a statement about the data rather than about the algorithms.

counting · Count
elements of block written per key insertedB-tree, in place49.3Log-structured, T = 23.0 · 16× less than the treeLog-structured, T = 42.0 · 25× less than the treeLog-structured, T = 81.0 · 49× less than the treeLog-structured, T = 161.0 · 49× less than the treeB = 64, M = 4,096 (M/B = 64)25× between the two structures at T = 4

The writes nobody counted

Sixteen thousand keys inserted into a B-tree write 49.3 elements' worth of blocks for every key stored. The same keys into a log-structured store write 2.0. Every operation counter reports the two as the same work — the same insertions, the same comparisons, the same number of updates — and the factor of 24 decides which structure a storage engine is built from.

applied · Transfer
adjacency scansrelaxationsqueue comparisonsvisitsKosaraju, two passes5,632Tarjan, one pass2,560V = 1024, E = 1,536, directed, components plantedevery segment counted exactly

Two passes or one, and what the second one costs

Kosaraju's algorithm and Tarjan's find the same strongly connected components of the same graph, in the same class, and one of them examines three times as many arcs as the other. The extra pass everybody counts is not where the difference is — building the reversed graph is, and no statement of "two depth-first passes" mentions it.

graphs · Graph
No estimate543 cells expanded · path 58Straight-line estimate325 cells expanded · path 58Estimate doubled71 cells expanded · path 64V = 900, E = 895, every edge costs onethe estimate is a function of the vertex, supplied by the caller

The precondition on a function the caller writes

Dijkstra expands 1,582 cells to find a path of 98 across a fifty-square grid. The same loop, with the straight-line distance to the goal added to each key, expands 405 and finds the same 98. The estimate has to be a function the caller supplies, and the guarantee holds only while that function never overestimates — a condition on somebody else's code, not on the graph.

graphs · Graph
agcacacggatcagccagggagta09101112131415161718192021229110101212141416171819192122101021011121314151718191920221110113101212141516171920192112121012411131314151718202119131312111351214131416181921211414131312146131413151719202115141514131314714151316181921161614161514141571416141719191717171517161515168151615182018171818151816161617816171519one unit = one subproblem given a value495 cells across three tables, 980 transitions

A cell that has to know where it is

A gap of four characters is usually one event, not four. No recurrence over a single table can charge it that way, because the price of a gap character depends on how the cell above it was reached and a cell holding one number has thrown that away. The repair is three tables, and it costs exactly three times the cells.

tables · Cost
executionintention87777776569888888765one unit = one subproblem given a value100 cells computed, 20 held at once

The table nobody has to keep

A million-cell table, computed cell for cell in the same order, holding two thousand cells at its peak instead of a million. The saving is exactly (n+1)/2, it costs nothing on any operation counter, and what it buys is paid for with the one thing the table was for.

space · Table
executionintention0136101521283645247111622293746555812172330384756649131824313948576572141925324049586673792026334150596774808527344251606875818690354352616976828791944453627077838892959754637178848993969899one unit = one subproblem given a value100 cells, filled in diagonal order

The order that has a depth

One hundred cells, filled in three orders, producing one table. Row order takes ninety-one steps and anti-diagonal order takes nineteen. Nineteen is not a property of the order — it is the longest chain of cells in the recurrence itself, no schedule can get under it, and every count taken until now was a total that could not see it.

tables · Table
024681,0244,09616,38465,536262,144keys, into as many bucketskeys in the busiest bucketone hashtwo hashes, take the emptierthree hasheslog n / log log nthe average load is 1 at every pointa lookup examines every choice, so two hashes is two probes

The second choice

Two hundred and sixty thousand keys into as many buckets. Under one hash the busiest bucket holds eight; under two, with each key going to whichever of its two is emptier, it holds four. The mean is exactly one in both. Nothing is rearranged afterwards, no key is ever moved, and the whole of the improvement is in a decision taken once, at the moment the key arrives.

randomness · Randomness
0%25%50%75%100%0.20.30.40.450.50.550.60.70.8keys per slotconstructions that failedconstructions that faileddisplacements, scaled to 36840 constructions per point, 256 slots per tablea lookup is two probes, whatever the keys are

An insertion that can fail

Every randomised structure in this field buys an expected cost and accepts a tail. Cuckoo hashing buys a worst case — a lookup examines exactly two slots, for any keys, always — and pays for it in the construction, which can fail outright. On a table of four thousand slots the construction never fails below 0.45 keys per slot and fails nineteen times in twenty above 0.55.

randomness · Randomness
executionintention0123456789112345667822234567773333455678434345667854444567776555555678766666656787777776569888888765one unit = one subproblem given a value110 cells for one divide step, 30 held

The alignment that fits in one line

Compute the table twice and hold three rows of it. The factor of two is a geometric series and is predicted exactly; measured, it comes down from 2.269 to 2.052 as the strings grow, and the peak is 3(m+1) cells on the nose.

space · Distance
1101001,00010010³position in the textLF stepsspan + sample = 64row sampling onlywith the secondsampling8,192 characters · sample one in 32 · span 32second sampling 3,598 bits

The sampling that goes the other way

An FM-index hands the text back, and the way it does it is to walk from the last character to the first. So thirty-two characters from the end cost thirty-three steps and thirty-two characters from the beginning cost eight thousand one hundred and ninety-two. The repair is a second array the same size as the first, indexed the other way round.

indexes · Index
1100ε — the exponent the fanout is B toelements written per key33445679ε = 1 — the B-tree ·fanout 256 · 3transfers a queryε = 0.5 · fanout 16 · 5a querythe number above eachpoint is what a querycostsB = 256, M = 16,384 (M/B = 64)131,072 random keys

One dial between two structures

A B-tree writes 226 elements of block for every key stored and a log-structured store writes two. They are presented as rival designs. They are one design at two settings of an exponent that nothing in either description mentions, and every setting between them is available.

applied · Transfer
gactacgatgattacagt112223334244352461647one unit = one subproblem given a value21 matching pairs, 21% of the rectangle

The cells that were never worth having

Two three-hundred-character strings over twenty-six letters give a table of 90,601 cells, and 3,421 of them are pairs of positions whose characters agree. Only those can lengthen anything. A method that enumerates exactly those computes a twenty-sixth of the table — and on a two-letter alphabet it computes half of it and is worse than the table it replaced.

tables · Table
1,00010,00010⁴10⁵characters in the collectionbitsFM-index, plainFM-index, compressedrun-length indexsample one in 64 · divergence 0 · r = 22411,900 bits at 32 copies

The index that stores the runs

A compressed self-index over thirty-two copies of a text is 30,557 bits, because its size follows an entropy that cannot see a copy. An index that stores the transform as its runs is 11,900 — and at a single copy it is the larger of the two, which is what makes the comparison a claim about repetition rather than about size.

indexes · Repeat
1,00010³window length W, in arrivalsbits of state heldW bits, exactε = 0.5ε = 0.2ε = 0.1ε = 0.05ε = 0.02sliding-window model · 40,000 arrivals · state from the shape of the structure5,670 bits at W = 8,000

What a window costs in bits

The approximate structure grows like the square of a logarithm and the exact one grows like the window, so the approximation wins eventually. Eventually is a window of 6,000 at a 2% tolerance — and below it the summary is larger than the thing it is summarising.

space · Window
4 bytes32 bytes128 bytes512 bytesrecord:QuicksortMerge sortShellsortHeapsortInsertion sortSelection sortBubble sortQuicksortShellsortMerge sortHeapsortSelection sortInsertion sortBubble sortQuicksortShellsortMerge sortSelection sortHeapsortInsertion sortBubble sortSelection sortQuicksortShellsortMerge sortHeapsortInsertion sortBubble sort1234567n = 512, random input, key 8 bytesa read or a write moves the record; a comparison touches the key

The exchange rate nobody wrote down

Three earlier essays have said in passing that the ranking would change if the elements were large records. None of them computed it. Computed, selection sort goes from second-worst of seven at four bytes a record to best of seven at five hundred and twelve — and the crossover against each rival is a division that takes one line.

counting · Count
balanced, bits49,2616.01 b/chHuffman-shaped, bits39,0614.77 b/chranks per access5.003.95entropy = 3.90 bitsEnglish-like, sigma = 22 · upper bar balanced, lower Huffman-shapedH0 = 3.90 bits/symbol

Rank is the only thing it does

Constant time and o(n) extra space — a phrase true of a rank directory costing 163% overhead and reading three words, and equally true of one costing 3% and reading eighteen. Both numbers are decided by two integers somebody typed into a header, and the phrase names neither.

machine · Index
1,00010,00010³bits of select supportpositions inspected, worst casebinary search, no extra bits: 510L=8L=256L=8L=256one position per L onesdense and sparse6,554 ones in 65,536 positions · sub-blocks of 8worst cases, every k

Select is not rank backwards

Rank counts the ones before a position and select finds the position of the k-th one, and only the first has an obvious structure. The constant-time answer costs 1.56 bits per one, is bounded in a unit the machine does not charge for, and on a vector with one bit in fifty it inspects more positions than the binary search it replaced.

machine · Index
above 0.01 of the stream · 13 really areone pass: 18 candidatestwo passes: 13 keys, exactly the heavy ones123456789101112131415161718128 counters · carry 1,376 bits5 of 18 spurious

The pass that was never a parameter

One pass is the streaming model's defining restriction, and this collection has enforced it by making a second read throw. A prohibition cannot be swept. Turn it into a dial and the first thing it says is that a second pass turns eighteen candidate heavy hitters, six of them wrong, into twelve that are exactly right — for 3,680 bits carried across the boundary and no extra space at all.

bounds · Pass
ttacgggacgtaccagtacgt000000000000000000111011110111011011222101221012101112333210122101211212433321123210122221one unit = one subproblem given a value90 cells, top row zero, answer read from the last row

The row that starts at zero

The same 1,413 cells, filled by the same recurrence in the same order, answer 148 and 0. One line of initialisation decides which question the table was asked, and only one of the two answers is about whether the pattern is there.

text · Distance
3,600 — the window opens4,000 — now32161616884the window edge215 in buckets−16 for the oldest= 200true 2000.3% outsliding-window model · ε = 0.2, k = 5 · 1,764 merges406 bits against 400

The summary that has to forget

Every structure in this field so far accumulates. Ask instead for the count over only the last thousand arrivals and no counter will do, because a counter has no record of which of its increments are old — and the repair is a row of buckets whose whole error is the oldest one.

streaming · Window
100,000110bits held by the whole indexLF steps per located occurrence1 in 11 in 21 in 41 in 81 in 161 in 321 in 641 in 128one point per sampling rate · 66 occurrences located each timeEnglish-like

The text that does not have to be kept

The index reproduces its text character for character, in 1,024 mapping steps and zero reads of anything. That is the whole justification for weighing it against the text rather than beside it — and the price is a dial that moves the structure by 3.3 times and the cost of locating one match by 72.

space · Index
sampled positions6,99041%phi predecessor3,95223%run starts2,09712%run lengths per symbol1,97012%run heads1,5389%C table5003%English-like · n = 16,385 · r = 233the sampling is the two shaded rowsone unit = one bit17,047 bits · 1.04 bits/char

The sampling that follows the runs

A run-length index over thirty-two copies of one text spends 11,286 bits on its suffix-array sampling and 5,605 on the transform it was built to compress. Sample at the run boundaries instead and the sampling is 10,942 bits that stop moving — two values per run, and a function that fills in everything between them.

indexes · Repeat
10×10³10⁴the key side, as a multiple of memoryblock transfersblock nested looppartitioned hash joinsort–merge joinB = 64, M = 512 (M/B = 8)the other relation: 16,384 rows

Two ways to join, and the ratio that decides

The same join costs 260 transfers one way and 1,040 the other; at eight times the memory the same two costs are 2,880 and 1,280, the other way round. Neither number is a property of how large the tables are. The quantity that decides is how the smaller of them compares to memory, and a rule of thumb phrased in rows is a rule about somebody's machine.

applied · Transfer
cells expandedreads building the estimateNo estimate1,572 expanded · path 356Straight-line estimate1,550 expanded · path 356A*, landmarks252 expanded · path 356 · 6,328 reads to buildV = 2,500, steps cost one to nine, seed 20260910shortest path 356

An estimate borrowed from an easier problem

On a grid where every step costs one, the straight-line distance to the goal cuts a search from 543 cells to 325. On terrain where steps cost between one and nine it cuts 1,572 to 1,550, because it still believes every step costs one. Four exact distance tables, computed once, cut the same search to 252 — and cost 6,328 reads to build, so they pay for themselves on the fifth query.

graphs · Graph
windowed HyperLogLog4,088 bitsone stamp per live key8,775 bitsblocks of Misra-Gries18,549 bitsthe last W keys, kept131,072 bitskeysstampspayloadindexthe parts, in the order they stackwindow 4,096 · the popular keys drift131,072 bits at most

The bits that say when

A windowed cardinality estimator holds 4,592 bits and 2,392 of them are clocks. Every summary in this collection has reported its size from the shape of its own structure, and not one of those numbers has ever been asked what the bits were for — so the resource that half of these structures spend most of their state on has been invisible while being counted.

streaming · Window
0231436845165232shards mergedkeys whose count movedthree orders:folded in one at a timecombined pairwise, in a treefolded in, last shard firstMisra-Gries, k = 32 · hashedworst gap 298 arrivals

What a fold charges per level

Thirty-two counter tables folded in a chain come out wrong by 323 where the same thirty-two combined pairwise are wrong by 148, and the quantile summaries prefer the chain by exactly as much in the other direction. What is being charged in each case is the depth of the fold, and the two families are charged on opposite ones.

bounds · Merge
10³10⁴10⁵10⁶passes over the datapeak bits of stateone pass, exact: 1,048,576 bitsradix, uniformsample, uniformradix, paretosample, paretoevery point exact · 32,768 values320 bits at best

What a second pass buys

Exact selection of a median from thirty-two thousand values needs the whole stream in one pass — a million bits — and eleven thousand in two. By nine passes it is three hundred and twenty. The state falls as n to the power one over p, which is a law with an exponent worth fitting, and on skewed data the deterministic rule misses it by three orders of magnitude.

space · Pass
11010010³10⁴12510rows the query actually matchescost ÷ the better plan's costrho plus the descent, 4.01estimate ÷64estimate ÷8estimate ×8estimate ×64n = 65,536, B = 64, M = 4,096 (M/B = 64), scattered read ×4dotted: the estimate switches at 512 rows

The estimate a plan rests on

A planner chooses between an index and a scan on how many rows it thinks will match, and the number it has is wrong by a factor. Guess sixty-four times too many on a narrow query and the scan it picks costs 13.5 times the index. Guess sixty-four times too few on a wide one and the index costs at most 4.01 times the scan — a ceiling that can be named before any query runs.

applied · Transfer
cash register — every key49,952 bitscash register — HyperLogLog2,560 bitswindow — a stamp per live key8,505 bitswindow — HyperLogLog5,494 bits40,000 arrivals · the popular keys drift, so old keys are gone rather than rare · W = 4,0961,561 distinct in the stream · 169 in the window20× against 1.5×

A register that became a list

HyperLogLog replaces a key per distinct item with a five-bit register, and over a whole stream that is a saving of a hundred times. Ask it about the last four thousand arrivals instead and the same comparison against the same exact structure comes out at five. The estimator did not get worse. The exact answer got cheap.

streaming · Window
10³10⁴capacity Wsubproblems given a valueBottom-up table · 1.00Top-down, reachable only · 0.14one unit = one subproblem given a valuesubproblems given a value, W from 200 to 3200

A table wider than its input

The knapsack table has (n+1)(W+1) cells and is called polynomial. Adding one character to the input doubles it — across four settings the table grows sixty-four times while the input it is written from grows by half.

wrong · Bound
0%25%50%75%100%1.5×shareheadroom over the mean occupancyoverflowingstanding idledrifting · 4.0 s window · 100 Hz47% overflow at the mean

Sized for a rate that does not hold still

A four-second window on a stream at a hundred arrivals a second holds four hundred items on average and between 105 and 2,169 when the rate moves. An allocation set at that average overflows at 47 per cent of instants while 35 per cent of it stands empty, which is the same decision failing in both directions at once.

practice · Window
key 05,416short by 4,163key 1462short by 4,154key 31short by 2,099key 71short by 943key 19401short by 3counter held (bar) against true count (tick)12 counters · 768 bits · no randomnessbound N/(k+1) = 4,615

The items that survive k counters

Misra-Gries keeps k counters, decrements all of them on a miss, and never returns a count above the truth — with no hashing, no randomness and no failure probability. At equal state it is more accurate than the randomised sketch on the question both are usually asked, at every size measured.

structures · Sketch
sampled positions3,855grows with nsample marks2,056grows with nrun starts2,016grows with rrun lengths per symbol1,885grows with rrun heads1,563grows with rC table525grows with r11,900 bits in total16,384 characters · r = 224 · sample one in 6450% is the sampling

What is still proportional to n

An index whose size is a function of the run count still has an n in it, and at thirty-two copies of a text the n is half of it. Everything that stores the transform grew by 45 per cent; the two arrays that answer "where" grew by eighteen times, and neither of them has anything to do with repetition.

space · Repeat
1,00010,00010⁴bits12481632characters in the collection · copies aboveFM-index, compressedr-indexphrase indexEnglish-like · divergence 0z 156 · r 233

An index with z in its size

Over thirty-two copies of one text, an index built on the parse is 8,892 bits, the r-index is 17,047 and the entropy-bounded index is 34,615. Over eight thousand characters of four-symbol text the same three are 7,844, 25,177 and 20,413, and the smallest of the three has changed places twice.

indexes · Parse
1,00010,000110occurrences12481632characters in the collection · copies aboveall occurrencessecondaryprimarypattern "ss is un" · z = 1561 primary · 31 secondary

The occurrences that cross a boundary

One pattern, thirty-two copies of a text, thirty-two occurrences. The search finds one of them and produces the other thirty-one by arithmetic, and the count it finds is the same one at two copies, at eight and at thirty-two — the searching does not grow when the answer does.

text · Parse
0000200121200the parenthesis sequencethe minimum excess of each block of 213 blocks · lookup table 72 bits, sharedblock 2 · 24 parentheses13 blocks

The table that fits inside a block

A block of six parentheses has sixty-four possible shapes and twenty-eight questions can be asked about each, so all 1,792 answers fit in a table of 9,408 bits — computed once, shared by every structure of that block length, and never counted in any of their sizes.

machine · Range
10⁵10⁶10⁷10³10⁴inversions in the permutationblock transfers to carry it outsort by destination, 1,536w 8w 32w 128w 512w 2048w 819216 swaps64 swaps256 swaps1024 swapsshuffled inside windowsa few pairs swapped farn = 16,384, B = 64, M = 512 (M/B = 8)inversions do not order the cost

The permutation that moves almost nothing

Two ways to scramble sixteen thousand elements. Shuffling them inside windows of five hundred and twelve puts two million pairs out of order and costs 3,095 block transfers to carry out. Swapping a thousand pairs across the whole array puts seven million out of order and costs 1,189. Inversions are the textbook measure of disorder, and on a disk they rank these two backwards.

applied · Transfer
0%25%50%75%100%0.30.40.50.60.70.80.850.90.95keys per slotconstructions that failed2 hashes, 1 slot3 hashes, 1 slot2 hashes, 2 slots2 hashes, 4 slots20 constructions a point, 256 bucketsa lookup reads hashes × slots, whatever the keys

More hashes or wider buckets

A cuckoo table with two hash functions and one slot per bucket cannot be built past about half full. Give it a third hash function and it builds to 0.92. Keep two hashes and give each bucket two slots and it builds to 0.89; four slots, past 0.95. Every shape keeps the worst-case lookup the plain table was built for, and every shape pays for its threshold in a different place.

randomness · Randomness
0.1%1%10%100%0.50.750.90.990.999quantile asked forrank error ÷ (1 − q)Greenwald–Khanna7,080 bitshigh-biased56,064 bitst-digest5,952 bits8 streams per point · ε = 0.01, δ = 100denominator: the tail

An error measured against the answer

A quantile summary asked for the 99.9th percentile answered 9,694 where the truth was 256, and violated nothing — its promise was a rank error under one per cent of the stream and it delivered a tenth of one per cent. One per cent of the stream is a thousand per cent of the tail, and no amount of extra state changes that.

streaming · Rank
1,000248163264high-biased, α = 0.56low-biased, α = 0.56none-biased, α = 0.74tuples keptshards mergedlog-normal, σ = 1.2 — a latency distribution · 20,000 valuesα 0.56 / 0.56 / 0.74 · worst residual 6.5%

The cheap tail and the expensive merge

A summary whose tolerance tightens towards the tail keeps seven times the tuples of a plain one on a single pass, and after merging sixty-four shards it keeps three and a half times as many. The error function that buys a useful tail promise is also the one that pays most for never having the values in one place.

space · Rank
1,00010,00010³10⁴characters of textcomparisons, built and scannedcrossing at n = 32,000both rules, exactlythe 1979 tables2 patterns of 10 · four symbolscrossing n = 32,000

The rule that pays on a long enough text

With two patterns, the cheap tables cost 106 steps and the scan reads 13,084 characters; the exact tables cost 594 and the scan reads 12,306. Below thirty-two thousand characters the cheap tables win the total, above it the extra skipping pays for them, and with thirty-two patterns there is no crossing at all.

practice · Symbol
2 halves, ties go left2 choices, ties at randomone choiceload 2 or more14,61015,03717,363load 3 or more2675785,250load 4 or morenone11,236load 5 or morenonenone223load 6 or morenonenone36load 7 or morenonenone2load 8 or morenonenone165,536 keys and buckets, seededbar length is log(1 + count)

The tie that breaks left

Two choices per key, the emptier bucket wins, and when the two are equally full a coin decides. Replace the coin with a rule — split the table into halves and always send a tie to the left one — and on a million keys the buckets holding three or more fall from 9,316 to 4,694, and the busiest bucket drops from four to three. The hashing, the probes and the keys are unchanged, and the rule spends no randomness at all.

randomness · Randomness
10³10⁴10⁵words in the vocabularysubproblems given a valueevery table in full · 1.16best so far · 0.99answer known · 0.96one unit = one subproblem given a valuesubproblems given a value, n from 250 to 2424

The bound the search finds for itself

A spelling checker that computes the full edit-distance table against every word in a 2,424-word vocabulary fills 156,714 cells for each misspelt query. Bound each table by the best distance found so far, and abandon it the moment a whole row exceeds that bound, and the same search fills 40,273 and finds the same words. Meet the candidates nearest in length first and it fills 26,203, starting a table for exactly the words a search that knew the answer in advance would start. The last factor of 1.7 is the price of not knowing, and it is largest when the misspelling is smallest.

tables · Table
answered 4,1900%25%50%75%100%11.794,190value, logarithmicfraction of the stream at or belowrank ±2%value 24.9–4,190answered 1553.5% out20,000 values · Pareto, α = 1.2 — a heavy tail · Greenwald–Khanna, ε = 0.02rank 0.10% · value 1553.5%

A promise about the rank is not a promise about the value

A quantile summary asked for the 99th percentile of a log-normal stream returns the largest value it ever saw — 2,169 against a true 318, six times too high — and its rank error is 1.00% against a promised 2%. The guarantee held. It was never about the number.

wrong · Rank
ε = 0.0515 → 29 (1.93×)ε = 0.0238 → 73 (1.92×)ε = 0.0177 → 136 (1.77×)ε = 0.005152 → 270 (1.78×)ε = 0.002397 → 674 (1.70×)reportedoccupied at the peak20,000 arrivals · lognormalpeak = resident + period, to 14%

The tuples a summary does not report

A Greenwald–Khanna summary at ε = 0.01 answers `tuples` with seventy-seven. Watched through the run it holds a hundred and thirty-six. The gap is the compression period, it is 1.70 to 1.93 times across every tolerance measured, and it is the number a deployment has to allocate.

space · Space
1,00010,00010⁴bits12481632characters in the collection · copies aboveFM-index, compressedr-indexphrase indexEnglish-like · divergence 0z 156 · r 233

The collection decides which index is small

Three compressed self-indexes over one text of five hundred characters measure 3,511, 7,285 and 10,974 bits. Repeat that text thirty-two times and the same three measure 34,615, 8,892 and 17,047 — the ordering has completely reversed, and nothing about any of the structures changed.

indexes · Repeat
1,00010,00010³10⁴characters of textsteps, precomputation plus scancrossing at 8,000published rulesexact rules2 patterns · four symbolscrossing 8,000 · was 32,000

Where the exact rules pay now

With a construction as cheap as the published one, the exact shift rules pay for themselves past eight thousand characters of text at two patterns, four thousand at four, and never at thirty-two — because by thirty-two patterns the two rules make identical decisions.

practice · Symbol
010010³10⁴interval extensions48.1%68.5%69.8%errors allowed · share removed belowno pruningpruned on D4,000 characters · m = 1669.8% removed at k = 3

The branch that cannot reach an answer

Seventy-two rank operations over the pattern remove 27,906 of the 39,957 interval extensions a bounded-error index walk performs — 70% of the tree, at a budget of three. The share grows with the budget, which is what a pruning has to do to be worth its cost.

bounds · Distance
0.020.050.10.20.5121235810filter bits a keywasted reads per absent lookupno filters: all 3 levelssame rate every levelrates sized to levelsn = 65,536, size ratio 4, first run 1,024 keysthe same memory at every point

The filter each run carries

A log-structured store turns every lookup for a missing key into a read of every level, and a Bloom filter on each run buys those reads back with memory. Spread five bits a key evenly across three levels and a missing key still wastes 0.279 reads. Give the small levels more bits and the large one fewer — the same memory — and it wastes 0.201. At four levels the gap is 0.382 against 0.209, because sized filters stop the waste growing with the number of levels.

applied · Transfer
0.01%0.1%1%10%100%1,0002,0003,0004,0005,0006,0007,0008,000keys insertedabsent keys answered yesone filterm = 19,171, k = 7; dotted: the design sizedashed: the design rate

A filter past its design size

A Bloom filter sized for two thousand keys at one per cent answers yes to 15.6% of absent keys at four thousand and 68.1% at eight thousand. Nothing fails and nothing warns. A stack of filters that adds a tighter layer whenever the top one fills holds 2.0% at eight thousand, under a bound it can state in advance — in 2.9 times the bits of one filter sized for eight thousand from the start.

randomness · Randomness
10³10⁴10⁵words in the vocabularysubproblems given a valueevery table in full · 1.16a trie, no bound · 0.99best so far · 0.99a trie, best so far · 0.82one unit = one subproblem given a valuesubproblems given a value, n from 250 to 2424

The columns the candidates share

Three thousand tables against one query, and most of them begin the same way. Stored as a trie, the 2,424-word vocabulary has 7,710 distinct prefixes holding 17,239 letters, and a search that computes one column per prefix reads 61,449 cells against 156,714 — before it applies any bound at all. Apply the bound at a prefix instead of at a word and it reads 16,958, beating a list search that was told the answer in advance.

tables · Table
10,000110sampling, bitssteps per occurrence1 in 21 in 41 in 81 in 161 in 321 in 641 in 128r-indexEnglish-like · 16 copies · r = 233pattern " time "

Every occurrence at the same price

A regular sampling has one dial and it moves two costs together — 1,495 bits at 63 LF steps an occurrence, 131,088 bits at none. A sampling at the run boundaries sits at 10,244 bits and one predecessor query, which is a point the curve reaches only at 69,649.

space · Repeat
124816nonephrasescap on the copy chainphrasesworst chainEnglish-like · 8,192 charactersz 156 to 7,351

A parse that will not follow a long chain

A greedy self-referential parse bounds the copy depth by nothing at all — thirty-two copies of a text give a position costing twenty-two phrase follows. Restricting every phrase to sources no deeper than D holds it at D, and the whole question is what that costs.

text · Parse
depth 0190.1%depth 19642.9%depth 24,92915.0%depth 37,00921.4%depth 48,47325.9%depth 56,24119.0%depth 63,31010.1%depth 71,2503.8%depth 84221.3%depth 91240.4%depth 10270.1%positions32,768 characters · 1172 phrasesmean 3.98

The number that would choose a cap

A depth histogram is one linear pass — 3.16 operations a character over thirty-two thousand of them — and it says the whole text sits at a mean depth of 3.98 with a worst of ten. Nobody prints it, and every choice of cap in this collection was made without it.

practice · Parse
trusts the estimateinsured ×2insured ×8always the index11.5235expected regret, logarithmic · label: worst within three standard deviationsrho 14.42.51.11.0rho 215.17.82.22.0rho 413.57.54.04.0rho 1616.016.016.016.0σ = 1.5, median error e^-1, 65,536 rowsexact over the error distribution

What insurance against an estimate costs

A planner that trusts its row estimate expects to pay 1.057 times the better plan and risks 7.76. One that insures itself by halving its estimate before it decides expects 1.057 and risks 4.10 — the insurance is free. At a read ratio of sixteen the same insurance costs six per cent in expectation and makes the worst case worse. Whether a conservative planner is paying a sensible premium depends on two numbers the planner can measure and usually does not — its device's read ratio and the direction its own errors run.

applied · Transfer
1,8103,6205,4297,239010,00020,00030,00040,000arrivals so farcount of key 1 in the last 4,096Misra-Gries, no clockblocks of Misra-Griesthe truth, and the ring buffera heavy hitter that stops · sampled every 5006,493 claimed, 0 true

The count that outlives its arrivals

A Misra-Gries counter holding six thousand is not a record of six thousand arrivals. It is a number that has been added to and taken from, and nothing in the structure says when any of it happened — so when the key stops arriving the counter stays, and goes on reporting a key with nothing in the window as the heaviest thing in it.

structures · Window
even5.1 s – 5.1 s1.00× · dispersion 0.00Poisson4.7 s – 5.5 s1.16× · dispersion 0.70bursty4.5 s – 4.5 s1.00× · dispersion 0.57drifting565 ms – 14.8 s26.14× · dispersion 849.57duration one block covered4,096 arrivals in 8 blocks · 100 Hz · 1 ms clock26.1× on the drifting stream

The window that is even in the wrong currency

A window of four thousand arrivals in eight blocks retires a block every 5.1 seconds on a steady stream and anywhere between 0.57 and 14.8 seconds on a stream whose rate moves. The structure cannot tell, because it is counting arrivals, and the alert written against it is in seconds.

streaming · Window
1,00010,00010phrases followed12481632characters in the collection · copies aboveworst depthmean depthEnglish-like · z = 156median 18 · 90th 31

The character that costs a chain

The index over thirty-two copies is 8,892 bits and does not grow. Producing one character of the text it indexes costs 17.89 phrase-follows on average and 38 in the worst case, against 2.38 and 7 at one copy — the size stopped growing and the price of reading it did not.

space · Parse
11010⁴10⁵worst copy chain, phrases followedbits124816noneno capcap on each pointEnglish-like · 16 copies of 512z 156 to 7,351

What a ceiling costs in phrases

A cap of sixteen costs one phrase of a hundred and fifty-six and halves the worst chain. A cap of four costs six times the phrases. The curve between them is flat at one end and vertical at the other, and the elbow is where a structure should be built.

indexes · Parse
10010100occurrences of the patternvisitsone visit an occurrencethe chainthe answer8 documents · m = 610 queries at every point

The cost that is the size of the answer

Ten range-minimum queries answer the listing at every point of a sweep where the occurrences run from 30 to 790. They cost 256 to 288 node visits — and the scan they replace costs 30 to 790, so the output-sensitive method loses until about thirty occurrences per document.

bounds · Document
1M2M4M16M64Mmean run length, in memoriesrandom33 runssorted1 runreversed64 runssorted, 1% arriving late2 runssorted, 10% arriving late7 runs262,144 records, 4,096 in memorydashed: two memories

Runs twice as long as memory

Feed 262,144 random records through a heap that holds 4,096 and the sorted runs that come out average 1.94 memories — the snowplow's famous factor of two. At a fan-in of 63 that saves a merge pass at 262,144 records, and at two of fourteen sizes in all. Feed the same heap a sorted file with one record in a thousand out of place and it writes two runs instead of sixty-four. And it spends 19 comparisons a record doing so, on every input, where sorting the chunks spends five on sorted data. The factor of two is the least of what the method does.

applied · Transfer
0.01%0.1%1%10%100%1,0003,0005,0007,0009,00011,00013,00015,000keys insertedabsent keys answered yesone Bloom filtera stack of Bloom filtersfingerprints, none reservedfingerprints, 3 reservedforecast 2,000, target 1.0%; dotted: the forecastdashed: the target rate

A filter that grows by moving a bit

A table of fingerprints can double in place, moving one stored bit of every fingerprint into its slot number, and so grow as one structure with one lookup where a stack of Bloom filters adds layers. Its false-positive rate is fixed by the fingerprint's length and not by the table, so with nothing reserved it doubles as the keys double — 0.69% at a forecast of 2,000, 5.7% at eight times that. Reserve three bits at the start and it holds 0.66% at eight times, in 294,912 bits, exactly what a table built for sixteen thousand keys would hold and fewer than the stack's 428,938. The reserve is a forecast of growth, and past it the rate climbs again.

randomness · Randomness
key 16,726exactkey 23,236exactkey 32,035exactkey 41,440± 2key 3109± 937key 42117± 937key 8402± 937key 14914± 937bracket, with the truth marked · widest 937 · 3 exactcash register · stationary Zipf · 32 countersthe smallest counter is 938

The counter that takes the smallest slot

Space-Saving keeps two numbers per key and they bracket the truth from both sides. On the twenty heaviest keys of a stream its mean error is a tenth of one arrival, against a hundred and ten for Misra-Gries at the same bits — and on the keys ranked past a hundred the ordering reverses.

structures · Sketch
10010³10⁴10⁵10⁶⌊1/2ε⌋ = 50151025501002005001,000tuples, and tuples examinedcompression period, in updatestuples examinedpeak tuplesresident tuplesworst rank errorε = 0.01 · 20,000 arrivalspeak 10× · work 72× · answer 1.21×

The period that is not a promise

Greenwald–Khanna's ε appears twice — once as the rank tolerance the structure promises, and once as ⌊1/2ε⌋, the number of updates between compressions. Unhook the second from the first and sweep it across a thousand-fold range. The tuples held move by 10%, the worst rank error by 21%, the peak by ten times and the housekeeping by seventy.

streaming · Rank
phrase table5,148 bitsboundary orders3,744 bitsintersection grid1,696 bitspropagation grid1,544 bitsz = 156 · ⌈log₂ z⌉ = 8 levels16,384 characters · 12,132 bitsgrids 26.7% · 20.8 bits a point

The structure paid for before the first query

The two grids that make a phrase index's search proportional to its answer are 3,240 bits on an 8,892-bit index — twenty-seven per cent of the whole structure, answering nothing on their own, and 38% of them is rank directory rather than payload — the lower-order term of the published bound, measured.

space · Grid
2·0·1·20101206·7·3·25·012012201012102rowsdocumentfirstpattern " was t" · 30 occurrences · 7 documentsA filled row is the first of its document. Reporting one costs a range minimum;reading every row costs one visit per occurrence.English-like · 8 documents30 rows · 7 documents

A list of documents is not a list of occurrences

A pattern occurring 790 times in eight documents has an answer of size eight. Reading every occurrence to find out costs 790 array reads; the question a collection has that a text does not is the one its index does not answer.

indexes · Document
10010100occurrences of the patternreadsthe scanchain, treechain, succinct8 documents · answer 8crossing 267 → 75

Where a crossing moved to

The prediction was that a succinct range minimum would move the document listing's crossing "to a handful". It moves it from 32 occurrences per document to 11 — a factor of three, not an order of magnitude — because a constant-time query is ten lookups rather than one.

bounds · Range
0%25%50%75%100%ln 2mean leaf fillrandom, even splits2,906 leavesrandom, rightmost-split rule2,949 leavesascending, even splits3,971 leavesascending, rightmost-split rule2,048 leavesdescending, even splits4,095 leavesdescending, rightmost-split rule4,095 leavesbulk-loaded from sorted keys2,048 leaves131,072 keys, leaves of 64each bar names its rule

The keys that arrive late

Insert 131,072 keys into a B+-tree in random order and its leaves end up 70.5% full; in ascending order, 51.6%; in descending order, 50.0%. The rule databases use to fix ascending inserts — split a full leaf at its right-hand end — fills them completely, and it does nothing for descending keys. Let one key in a hundred arrive late in an otherwise ascending stream and the rule's leaves fall from 100% to 53.4% full. How much of an index is empty is decided by the order its keys arrived in, and a trickle of disorder undoes the fix.

applied · Transfer
124816nonephrasescap on the copy chainphrasesworst chainEnglish-like · 8,192 charactersz 156 to 7,351

The term that came back

A phrase index is worth building because 8,192 characters parse into 156 phrases. Cap the copy depth at one and the same text parses into 7,351 — ninety per cent of the characters — and the structure is proportional to the text again.

space · Parse
1234567characters addedoccurrencesgrown leftwardsgrown rightwards"tgatatt"4,000 characters · four symbols1 occurrences

An interval that grows at both ends

A backward search step is two ranks. A bidirectional step is two ranks and the width of the interval for every symbol that sorts before the one being added — 16.5 ranks on four symbols and 138.6 on twenty-six, which is a cost no account of the structure mentions.

indexes · Distance
right to left8302.74xleft to right8772.89xone per piece4471.48xthe scheme3031.00xinterval extensionsall four found the same 6 positions15 characters · k = 22.74x apart

The search that starts in the middle

The same pattern, the same six occurrences, the same index — and 830 interval extensions, or 303, according to which end the search begins at. A pattern cut into three pieces has an error-free one, and only a search with two ends can start there.

text · Distance
11010³cap on the depthphrases9.8% more phrasesevery occurrence consideredthe earliest only4,096 charactersworst at cap 4

The cap an automaton cannot see

A state of a suffix automaton stands for a set of occurrences and hands back one of them. So a capped parse driven by it can ask whether the earliest occurrence is shallow enough and cannot ask whether any occurrence is — which costs up to 9.8% of the phrases, and only at the caps that bind.

bounds · Parse
00.2500.5000.7501010203040age of an arrival, secondsweight it carries nowexponential, half-life 4.0 sbackward polynomial, α = 2, scale 4.0 sforward, β = 2, landmark 20 s backforward, β = 2, landmark 160 s backdotted: half weightweights at the moment of reading

A decay measured from where it started

An exponentially decayed counter is one number because its weights fade by elapsed time alone. Forward decay keeps a polynomial weight in one number too, by measuring each arrival from a fixed landmark. Its memory is then a share of the time since that landmark: at β = 2 an arrival counts half at 29% of that time. Anchored at the start of a stream, it takes 5.3 seconds to register a fourfold rise twenty seconds in and 83 seconds when the rise comes at five minutes.

streaming · Decay
folded in one at a time2,616 tuples17 ranks outcombined pairwise, in a tree3,637 tuples17 ranks outfolded in, last shard first2,615 tuples17 ranks outtuples kept, and worst rank error against a promise of 10032 shards · ε = 0.01 · high-biased · round1.39× the space, 0 ranks of answer

The shape that moves the bill

Thirty-two quantile summaries combined pairwise keep 3,637 tuples and the same thirty-two folded in one at a time keep 2,616, for answers that differ by nothing at all. The counter tables measured for the same thing do the opposite — their order moves the answer and leaves the space alone.

structures · Rank
ranks to compute D72extensions removed27,906extensions remaining12,051one search · k = 3 · 4,000 charactersand one more index: 17,033 bits4,000 characters · m = 16388 extensions a rank

A bound that has to be paid for

The pruning removes seventy per cent of a search tree for seventy-two rank operations. It also needs an FM-index of the reversed text — 17,033 bits against the forward index's 17,032 — which doubles the structure whose small size was the entire argument for walking an index.

space · Distance
plain51,600block-coded47,6687.6%run-coded60,805-17.8%plain, uniform51,600block-coded, uniform50,2422.6%run-coded, uniform67,121-30.1%bits · the lower three are a permutation with no structure3,612 points7.6% against 2.6%

A block, a class and an offset

Replacing each block of a bit vector by how many ones it holds and which arrangement it is takes 7.6% off the grid. On a permutation with no structure at all it takes 2.6%, so five of the seven points are the data and two of them are the encoding.

indexes · Grid
1,00010⁴10⁵10⁶charactersoperationscharacter comparisonstransitions and linksrepetitive · 8 copies346 phrases at 8,192

The parse in one pass of the text

The same parse, phrase for phrase, from 1,324,336 character comparisons or from 25,420 transitions and suffix-link steps. One of those numbers grows with the text and the other grows with its square, and the difference is why every measurement about a depth cap here was taken on a few thousand characters.

text · Parse
weighted path lengthΣ wᵢdᵢ — what Huffman minimisescuts takenΣ over the mergesdamageworst error leftchaintreesmallest-firstlargest-first543k147k123k738k309254259388323148183403Misra-Gries · 32 shards · hashedleast path smallest · least damage balanced

The fold that minimises the wrong thing

A fold charges per level and a survivor pays the cuts on its path, so the bill looks like a weighted external path length — and Huffman's construction minimises that quantity by proof. Built and measured on thirty-two uneven shards it does minimise it, 181,407 against a balanced tree's 200,000, and leaves more damage than the tree does.

structures · Merge
run together38,400 bitsσ 21 · 5 bitsone separator38,470 bitsσ 22 · 5 bitsa separator each46,164 bitsσ 35 · 6 bits15 documents of 512 charactersthe separators are the only differenceEnglish-like · 15 documents1.20x for the distinct marks

One separator, or one for each

A shared separator costs one alphabet symbol and is free. Fifteen distinct ones take the alphabet from twenty-two to thirty-five, which crosses a power of two, so every character of every document costs a sixth bit — 1.2 times the packed collection, to tell the boundaries apart.

space · Document
counter tablesworst error, ratio to bestquantile summariestuples kept, ratio to bestchain2.18× (323)1.10× (2,807)tree1.00× (148)1.26× (3,211)smallest-first1.24× (183)1.28× (3,278)largest-first2.72× (403)1.00× (2,556)32 shards · hashed · k = 32each column against its own best shape

The shape one structure will not fold

Folding thirty-two shards largest-pair-first keeps 2,556 quantile tuples against a balanced tree's 3,211 — a fifth of the space saved. The same fold on the counter tables beside them leaves 403 counts of error against the tree's 148. A deployment holding both cannot fold once and be right twice.

structures · Merge
parentheses131,07216.7%select support115,71214.8%superblock minima16,3982.1%superblock table80,97010.3%block minima147,46518.8%block tables291,25537.2%the partsbitstotal 782,872 · the segment tree 2,228,224shared lookup table 82,944, not counted65,536 values · openings in index order, found by select2.85x smaller

Two bits a value, and what undoes them

The parentheses of a range minimum over 65,536 values are 131,072 bits. Everything that makes them answerable is 651,800 more — five times the payload — and one encoding choice nobody quotes accounts for a sixth of it on its own.

space · Range
01002003004005006007008009001000roundloads 1.0×blockedloads 1.0×hashedloads 17.6×worst error over the heaviest keyschaintreesmallest-firstlargest-first32 shards · k = 32 · 40,000 arrivalseven 1.00× · uneven 2.7×

A parameter that waits for another

Four merge fold shapes over thirty-two evenly loaded shards leave errors of 665, 667, 665 and 667 — a fifth of a per cent apart. Give the same four shapes shards whose loads span seventeen-fold and they leave 148, 183, 323 and 403. The parameter did nothing until a second parameter moved, and every measurement that fixed the second one saw nothing.

wrong · Merge
one index35,3354.31 bits/charthe forward half35,3354.31 bits/charthe reverse half35,3354.31 bits/charboth, which is the structure70,6708.63 bits/charbits8,192 characters · sample 322.00x one index

The structure that was supposed to halve

A bidirectional index holds the transform of the text and the transform of its reversal — 35,335 bits each, 70,670 together, exactly twice one index. The deferral that named it hoped it would stop the index doubling. It does not remove the doubling; it reuses it.

space · Distance
6080100how far a full leaf looks for room, in siblingsmean leaf fill, per cent12481664randomascendingdescendingascending, 1% late131,072 keys · leaves of 64 · fan-out 64a reach of 1 is the adjacent-sibling rule

A key passed along the row

A full B+-tree leaf that offers a key to its immediate neighbours before splitting leaves an ascending stream 67.2% full. Let it look one sibling further and the same stream fills its leaves completely, 2,048 leaves where there were 3,048, for about the same key moves. On random keys each doubling of the reach adds a few points of fill and more writes than it saves, and at the whole parent a key travels sixteen leaves on average. On a stream that is mostly in order the same reach costs almost nothing.

applied · Transfer
00.2500.5000.750101234567891011level of the wavelet treebits a bitthe parse's grida uniform permutation3,612 points · 12 levels0.997 bits a bit

A bit for every bit

A grid over 3,612 points is 43,344 bits of payload. The smallest any structure can be that distinguishes one permutation of 3,612 things from another is 37,485. There is 16% to play for, and the deferral that asked for a compressed grid assumed there was much more.

space · Grid
English-like, 32 copies0.05x0.017 runs/charEnglish-like, 8 copies0.12x0.045 runs/chara text that repeats itself0.08x0.029 runs/charEnglish-like0.80x0.292 runs/charfour symbols, uniform2.07x0.753 runs/charthe whole suffix arraysampling bits, run boundaries / every valuen = 8,192

A sampling that costs more than the array

On four-symbol text the transform has 0.75 runs a character, so a sampling of two suffix-array values per run is one and a half values per position — 271,565 bits against the 131,088 that keeping every value costs. The structure built to remove a term proportional to the text is twice the thing it replaced.

wrong · Repeat
the whole table60,00060,000r · 0rkcounting filter24,84315,369r · 0rkseed filter17,7452,415r · 1,377rkindex walk00r · 177,046rkn = 3,000 · m = 20 · q = 4cells drawn · r = characters read, rk = index rankscells computed6 occurrences

Three savings in three currencies

The same six occurrences, found four ways. The table computes 60,000 cells and reads 60,000 characters. The counting filter computes 6,251 cells and reads 13,022 characters. The seed filter computes 3,325 and reads 550. The index walk computes none, reads none, and performs 18,645 ranks.

wrong · Distance
a text that repeats itself2.96xchain 13 · z 110English-like1.31xchain 10 · z 604four symbols, uniform1.28xchain 10 · z 816periodic, period 171.11xchain 9 · z 1,285phrases under a cap of four, against no cap4,096 characters each2.96x to 1.11x

The cap that binds on one text and not another

A periodic text looks like the one made of chains and pays 1.11 times the phrases for a cap of four. A text that repeats itself pays 2.96. The guess is backwards, and the reason is that depth measures nesting rather than repetition.

wrong · Parse
errors, by piecetaken by(0, 0, 0)1(0, 0, 1)1(0, 0, 2)1(0, 1, 0)1(0, 1, 1)1(0, 2, 0)3(1, 0, 0)2(1, 0, 1)2(1, 1, 0)3(2, 0, 0)30 of 10 covered more than once · the numbers are the searchesk = 2 · 3 pieces10 distributions

A schedule nobody writes down

A search scheme is valid when its searches between them cover every way the errors can fall — ten cases at two errors, enumerable in a line. A scheme missing one of them finds seven occurrences of eight, all real, at the right error counts, and reports nothing wrong.

wrong · Distance
02e+34e+36e+301234567891011level of the wavelet treebitsplainblock-codedrun-coded3,612 points · 12 levels24 copies of 2048 characters

The level where compression stops paying

Choosing the best coding for every level of the grid separately, rather than one for all twelve, saves 26 bits out of 47,668 — five hundredths of one per cent. The apparatus for choosing costs more than that to describe.

wrong · Grid
11010⁴cap on the depthphrasesno capcap 165,536 characters · 16 copies26x at cap 1

What a quadratic construction was setting

A depth cap of one costs 90% of an 8,192-character text in phrases, and 86% of a 65,536-character one. The ladder's conclusions hold at thirty-two times the size — and the number the ladder could not reach, the deepest chain a real collection produces, turns out to be fourteen.

wrong · Parse
rounds, if every ready cell ran at oncerow by row65,793column by column65,793anti-diagonal by anti-diagonal513reads that miss the cacherow by row6.3%column by column28.2%anti-diagonal by anti-diagonal31.1%fully associative · 32 lines × 8 elements · LRU263,169 reads and writes per order

The order with the best depth

An edit-distance table can be filled row by row, column by column, or one anti-diagonal at a time, and the anti-diagonal order is the one that needs the fewest rounds — 513 against 65,793 on two strings of 256 characters, because every cell on an anti-diagonal is independent of the others. Stored the usual way, row by row, it also misses the cache on 31.1% of its reads, where row order misses 6.3%. The order that is best for parallel work is worst for the memory it runs on.

machine · Machine
rounds, if every ready cell ran at oncerow order, stored by rows65,793anti-diagonal order, stored by rows513anti-diagonal order, stored by diagonals513reads that miss the cacherow order, stored by rows6.3%anti-diagonal order, stored by rows31.1%anti-diagonal order, stored by diagonals8.7%fully associative · 32 lines × 8 elements · LRU263,169 reads and writes per order

The table stored the way it is filled

Store an edit-distance table by anti-diagonals instead of by rows, and the anti-diagonal fill keeps its 513 rounds while its cache misses fall from 31.1% of reads to 8.7%. It does not fall to row order's 6.3%, and the gap is not noise — on caches of four and eight lines the two rates are 9.4% and 6.3%, exactly three to two, because a cell reads from two earlier diagonals and only one earlier row. The same layout turns row order into the order that strides, at 28.3%. How a table is stored and the order it is filled in are one decision, and its price is the number of earlier fronts the recurrence reads.

machine · Machine

Named alongside it

The objects these essays reach for when they reach for this one.

MeasurementIndex sizeSpace overheadHonest limitSelf-indexState bitsRepetitionGuaranteeFM-indexMeasured countParameter choicePhrase

All concepts